ASPICdb Help Guide
ASPICdb is a database tool for alternative splicing analysis
that collects the results obtained by ASPIC algorithm (Castrignanò et al. 2006) applied to the complete set of human genes for which a NCBI Reference mRNA sequence and a Unigene cluster are available. In the near future, we plan to include the full gene set of other organisms.
This help page is intended to introduce new users to ASPICdb providing information on the basic retrieval procedures.
If you wish to analyze the splicing pattern of a specific gene just type its Hugo ID in the “Search for Gene” form shown below:
Alternatively, other IDs can be used such as Unigene (e.g. Hs.654481), RefSeq (e.g. NM_000546), Entrez (e.g. 7157), MIM (e.g. 202300).
You can also search for more than one gene, by using
the “More” option, which opens new text boxes for inputting the names of
additional genes.
The middle panel allows a keyword search (e.g. survinin) whereas the lower panel of the search form is devoted to Gene Ontology searches. You can retrieve genes related to a given GO ID (e.g. GO:0000739) or to GO categories matching text terms related to the biological “function”, the cellular “component” or the biological “process” (e.g. mitochondrion).
The same form appears by clicking on the “Search” button on the left menu.
If you wish to carry out an Advanced Search just click this item on the left menu, and then, first of all, select “genes”, “transcripts” or “splice sites” depending on the type of search you wish to perform.
Depending on the choice made a new form appears.
1) Gene retrieval form
The form is split into
two parts (A and B), allowing the search for genes fulfilling one or more
criteria (A) and/or showing a specific expression profile in normal/tumor cells
of a given tissue (B).
(B)
Organism: select the species (only human is
available to date)
Accession: retrieve a gene with a given Unigene (e.g. Hs.654481), RefSeq (e.g. NM_000546), Entrez (e.g. 7157), or MIM (e.g. 202300) ID.
Keyword: retrieve all genes characterized by a given keyword (e.g. survivin)
Coordinates: retrieve all genes falling within the
given chromosome region.
Alternative splicing
events localized in:
retrieve genes with alternative splicing affecting the 5’UTR, the CDS or the 3’UTR
Type of splicing
event: retrieve genes with one
or more type of splicing event (e.g. exon skipping,
alternative 3’ end, etc.)
Donor or Acceptor
site: retrieve genes
containing at least one splice site with the chosen assortment of donor and
acceptor splices (e.g. AT/AC).
Intron class: retrieve genes containing U2, U12 or unclassified (ND) introns.
Number of alternative
transcripts: retrieve genes
generating a specific number (range) of alternative transcripts (e.g.
≥50).
Number of alternative
proteins: retrieve genes
generating a specific number (range) of alternative proteins (e.g. ≥50).
Number of independent splicing events: retrieve genes with a specific number (range) of independent splicing events (i.e. a specific exon skip can be predicted in more than one alternative transcripts, but it is counted only once).
NMD related transcripts: retrieve all genes encoding (PTC+) or not (PTC-) transcripts containing a premature stop codon.
In the expression pattern section (form B) you can
retrieve genes: 1) exclusively expressed in tumor cells (TT); 2) significantly
more expressed in tumor cells (T); 3) equally expressed in tumor and normal
cells (E); 4) significantly more expressed in normal cells (N); exclusively
expressed in normal cells (NN). You can also specify one or more tissues of
interest.
The above classification
is derived by a chi-square statistical analysis carried out on each gene
provided that the following conditions are fulfilled: i)
≥10 EST available from the given normal and tumor tissue; ii) library
size for both normal and tumor tissue tissue ≥ 40.000 clones. A P-value threshold can also be defined to narrow the search.
where
xn
and xt are the observed number of ESTs in the normal and tumor cDNA libraries of size Ln and Lt, respectively.
After the query is completed,
a Result Table is shown, like in the example below.
For each gene, the
result table reports the Hugo, Unigene and RefSeq IDs, a short description, the chromosome location, a link to the ASPIC
results (see ASPIC output section), the number of alternative transcripts,
alternative proteins and independent splicing events, a link to the expression
table and the date of the ASPIC run that generated the predictions stored in
the database.
2) Transcript retrieval form
The form allows for the
search of single transcripts fulfilling one or more criteria. Organism: select the species (only human is
available to date) Accession: retrieve all transcripts encoded by a gene with a given Unigene (e.g. Hs.654481), RefSeq (e.g. NM_000546), Entrez (e.g. 7157), or MIM (e.g. 202300) ID.
Coordinates: retrieve all transcripts from genes
falling within the given chromosome region. Alternative splicing
events localized in:
retrieve transcipts with alternative splicing affecting the 5’UTR, the CDS or the 3’UTR Type of splicing
event: retrieve transcripts
with one or more type of splicing event (e.g. exon
skipping, alternative 3’ end, etc., all events are referred to the reference
transcript) Donor or Acceptor
site: retrieve transcripts
whose precursor mRNA contains at least one splice site with the chosen
assortment of donor and acceptor splices (e.g. AT/AC). Intron class:
retrieve transcripts derived from a gene containing U2, U12 or unclassified (ND) introns. PolyA:
retrieve transcripts containing a polyA tail and a poly-adenylation signal (e.g. AAUAAA). NMD related transcripts:
retrieve all transcripts containing (PTC+) or not (PTC-) a premature stop codon. CDS length:
retrieve all transcripts with an annotated CDS in the required length range. 5'UTR/3'UTR length:
retrieve all transcripts with an annotated 5' or 3'UTR in the required length range. Number of exons:
retrieve all transcripts generated by the concatenation of a number of exons in the required length range. After the query is
performed a Result Table is shown, like in the example below. For each transcript, the
result table reports the Hugo ID of the relevant gene, the Unigene
and RefSeq IDs, the chromosome location, the number
of exons, the transcript length, the position of the
CDS, the protein length, the usage or not of the reference transcript
start/stop codons and reading frame, and a link to
the ASPIC results (see ASPIC output section).
3) Splice site retrieval form The form is split into
two parts, allowing for the search of introns
fulfilling one or more criteria (upper) or showing a specific expression profile
in normal/tumor cells of a given tissue (lower). Organism: select the species (only human is
available to date) Accession: retrieve all introns included into a gene with a given Unigene (e.g. Hs.654481), RefSeq (e.g. NM_000546), Entrez (e.g. 7157), or MIM (e.g. 202300) ID. Coordinates: retrieve all introns
from genes falling within the given chromosome region. Donor or Acceptor
site: retrieve introns with the chosen assortment of donor and acceptor
splices (e.g. AT/AC). Intron class:
retrieve U2, U12 or unclassified (ND) introns, whose prediction also supported by a given number (range) of ESTs (you can specify either parameter, or both). Intron length:
retrieve all introns in the required length range. In the expression pattern section (lower section) you
can retrieve splice sites (introns): 1) exclusively
expressed in tumor cells (TT); 2) significantly more expressed in tumor cells
(T); 3) significantly more expressed in normal cells (N); 4) exclusively
expressed in normal cells (NN). You can also specify one or more tissues of
interest. The above classification
is derived by a z-score statistics according to Wang et al. (2003). A P-value threshold can also be defined to narrow the search according to the statistical significance. After the query is
performed a Result Table is shown, like in the example below. The Table shows the Hugo and Unigene
IDs, the intron number (following the progressive
numeration in the ASPIC output) the intron length, the number of supporting ESTs, the donor and acceptor dinucleotides, and the intron class. Link are provided to the expression pattern (see the section on “Expression pattern (intron)”) and to the ASPIC output (see the section on the ASPIC output). EXPRESSION PATTERN TABLE (GENE) If you click the link for the expression pattern for a given gene, a
table like the following is displayed: where for each tissue are shown the number of ESTs derived from the normal and tumoral tissues, their library size, the chi-square P-value, and the classification: TT) exclusively expressed in tumor cells ; (T) significantly more expressed in tumor cells; (E) equally expressed in tumor and normal cells; (N) significantly more expressed in normal cells; (NN) exclusively expressed in normal cells. A dash (-) appears if the total number of ESTs or the library size are below the settled threshold (≥10 ESTs, >40.000 clones). EXPRESSION PATTERN TABLE (SPLICE SITE) If you click the link for the expression pattern for a given intron, a table like the following is displayed: where for each intron is shown the number of
supporting ESTs from normal and cancer tissues, the
P-value determined according to the z-score calculation by Wang et al. (2003)
and the classification: (TT) exclusively expressed in tumor cells ;
(T) significantly more expressed in tumor cells; (N) significantly more
expressed in normal cells; (NN) exclusively expressed in normal cells. DATA AND SEQUENCE DOWNLOAD
After a query has been accomplished at the gene (A) , transcript (B) or splice sites (C) level you can download specific sets of sequences in multiFASTA format (e.g. genes, transcripts, proteins, 5’UTRs, coding sequences, 3’UTRs, introns) as well as sequence regions surrounding splice site boundaries. Such sequences may subsequently used for customized sequence analyses such as pattern matching and discovery approaches aimed at the identification of splicing regulatory elements.
The sequence header
univocally labels each extracted sequences including the gene name, the
transcript or intron number (as in the Aspic output),
etc.
>TP53 | Intron2 | donor site As the sequence file generation may be time consuming you
have to provide a valid e-mail address to which he will receive
notification that the requested file in zipped format is available for
downloading, together with a link for its download. ASPIC OUTPUT
The ASPIC output is organized in 6 sections: 1) Gene Information; 2) Gene Structure View; 3) Predicted Transcripts; 4) Predicted Splice Sites; 5) Intron Table; 6) Transcript Table.
Gene Information. Provides a summary of the submitted input and
information retrieved by the ASPic engine (e.g.
chromosome number, start, end, strand, etc.). Links in this section allow the
user to view or download input sequences.
Gene Structure View.
Provides a schematic graphical view of the gene structure (RefSeq exons in blue, novel exons in red) and of the predicted introns (numbered progressively). Known and novel introns are shown as blue and red lines, respectively. Fuzzy introns (i.e. introns with limited support by EST sequences and flanked by non-canonical splice sites) are shown as dashed lines. The structure of the RefSeq gene is shown in red.
Predicted Transcripts.
This view provides a graphical representation of the assembled transcripts. Only the most reliable introns (i.e. those supported by a perfectly aligning EST with canonical donor and acceptor splice sites, or those supported by two or more ESTs) are used for the assembly process. The Predicted Transcripts View shows the overall exon-intron scheme and also reports the annotation for 5'UTR, CDS, 3'UTR, premature stop codons (PTC) and polyA site. The first transcript used as reference, corresponds a NCBI RefSeq transcript, and it is named from the Hugo ID with the ".Ref" extension (e.g. TP53.Ref). If more RefSeq transcripts are annotated for the same gene, is chosen the longer one with the highest number of exons. A 3' terminal arrow (¯) marks polyadenylated transcripts that may also contain a polyA site (AAUAAA or its accepted variants). Alternative transcripts containing ORFs longer than 100 codons are annotated as coding mRNAs, whereas transcripts containing ORFs shorter than 100 codons are labeled "Unannotated RNA".
Predicted Splice Sites.
This view shows the alignment between the genomic sequence and the transcribed sequences near the predicted intron boundaries (15 nt upstream and downstream of intron boundaries). The donor and acceptor quality score as well as the classification as U2 or U12 introns is done according Sheth et al. (2006). A branch site is searched within 200 bb from
the acceptor site and annotated when its score is ≥0.75.
Intron Table.
Reports the relative and absolute coordinates of each detected intron, the number of supporting ESTs, the intron length, donor and acceptor splice sites, the alignment quality near intron boundaries (expressed in Mismatch %) and the intron class (U2 or U12). Known introns
related to RefSeq transcripts are in red.
Transcript Table.
Shows the general features of all alternative
full-length transcripts. It includes information about: the length, the number of exons, the putative location of the CDS, the occurrence of start/stop codons in the reference transcript, the frame sharing with reference mRNA, the length of the putative encoded protein and the transcript variant type. The variant type column reports - for each full-length transcript - the type of splicing event (e.g. alternative 5’ or 3’ end, exon skipping, etc.), the affected exon or intron as well as its location in the coding and/or untranslated regions of the transcript. Splicing variants are labeled with respect to a reference transcript (the longest transcript in the RefSeq database, see http://www.ncbi.nlm.nih.gov/RefSeq/) if available, or by the longest transcript. The CDS annotation is done accoording to the following procedure. If the transcript isoform totally overlaps or includes a known mRNA (e.g. a RefSeq entry with a CDS linked to a Swissprot/Uniprot curated peptide) the RefSeq annotation is taken in ASPICdb.
For the other assembled .novel. transcripts (i.e. those listed in the .predicted transcripts. section of the output, not coinciding with the known RefSeq transcripts) a fully automated reliable prediction of ORFs able to cover every case is almost impossible to obtain without any human correction or experimental validation. Therefore, in order to assess correctly the most common situations we introduced the following criteria: i) if the transcript isoform contains the start codon of the RefSeq transcript then the CDS is annotated as the ORF starting at this ATG, unless a longer ORF in-frame with the RefSeq annotated protein is found; ii) if the transcript does not contain the start codon of the RefSeq transcript (and thus may be potentially truncated) the longest ORF is annotated as the CDS if longer that 300 nt. In this case, no ORF is annotated in shorter than 300 nt. Used abbreviations for splicing events are: A3E, A5E:
alternative 5’ or 3’ends (the affected intron number
and the length difference with respect to the reference transcript is shown in
brackets, e.g. I8, -36nt); skip New, novel exon(s) not present in the reference transcript (e.g. E(9a), means a new exong after exon 9 of the reference transcript); Init, alternative starting exon(s) (e.g. E(0a), means an alternative initiation exong before exon 1 of the reference transcript); Term, alternative termination exon
(in brackets the exon number, e.g. E8); IR, intron retention (IR- or
IR+ are used depending on the intron is present or
not in the reference transcript; the length difference with respect to the
reference transcripts related to the IR event is also reported in the
brackets); After each splicing event is also reported the affected location in the reference mRNA: 5UTR (5’UTR); CDS; 3UTR (3’UTR); uCDS (5’UTR and CDS); CDSu (CDS and 3’UTR); GTF. Provides a full textual output of ASPic including: i) absolute intron coordinates and IDs of supporting ESTs; ii) intron composition of assembled transcript isoforms; iii) absolute exon coordinates; iv) exon composition of assembled transcript isoforms; v) nucleotide sequence of assembled transcript isoforms in FASTA format (header line reports IDs of polyadenylated transcript). Bibliography Castrignano T, Rizzi R, Talamo IG, De Meo PD, Anselmo A, Bonizzoni P, Pesole G. ASPIC: a web resource for alternative splicing prediction and transcript isoforms characterization. Nucleic Acids Res. 2006 Jul 1;34 (Web Server issue):W440-3. Wang Z, Lo HS, Yang H, Gere S, Hu Y, Buetow KH, Lee MP. Computational analysis and experimental validation of tumor-associated alternative RNA splicing in human cancer. Cancer Res. 2003 Feb 1;63(3):655-7






(A) Gene Download Form

(B) Transcript Download Form

(C) Download Form

TTCCTCTTGCAGCAGCCAGACT
>TP53 | Intron2 | acceptor site
CCTGGATTGGGTAAGCTCCTGACTGAACTTGA
>TP53 | Intron6 | donor site
TCCCAGCATTTCGGGAGGCTGA
>TP53 | Intron6 | acceptor site
CCCAGCACTTTGGGAGTCGGAGGCGGGAGGAT


